Antibodies
Anti-FOXO3A Antibody-Oligo Conjugate (ARC78518_ARC78524)
SKU: aoc2099
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FOXO3A Antibody (ARC78518_ARC78524)-IF1
Antibody Target
- Target
- Forkhead box protein O3
- UniProt Number
- O43524
- Target Description
- Transcriptional activator that recognizes and binds to the DNA sequence 5'-[AG]TAAA[TC]A-3' and regulates different processes, such as apoptosis and autophagy (PubMed:10102273, PubMed:16751106, PubMed:21329882, PubMed:30513302). Acts as a positive regulator of autophagy in skeletal muscle: in starved cells, enters the nucleus following dephosphorylation and binds the promoters of autophagy genes, such as GABARAP1L, MAP1LC3B and ATG12, thereby activating their expression, resulting in proteolysis of skeletal muscle proteins (By similarity). Triggers apoptosis in the absence of survival factors, including neuronal cell death upon oxidative stress (PubMed:10102273, PubMed:16751106). Participates in post-transcriptional regulation of MYC: following phosphorylation by MAPKAPK5, promotes induction of miR-34b and miR-34c expression, 2 post-transcriptional regulators of MYC that bind to the 3'UTR of MYC transcript and prevent its translation (PubMed:21329882). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription (PubMed:23283301). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription. Also acts as a key regulator of chondrogenic commitment of skeletal progenitor cells in response to lipid availability: when lipids levels are low, translocates to the nucleus and promotes expression of SOX9, which induces chondrogenic commitment and suppresses fatty acid oxidation (By similarity). Also acts as a key regulator of regulatory T-cells (Treg) differentiation by activating expression of FOXP3 (PubMed:30513302)..
- Molecular Weight
- 71 kDa/48 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC78518_ARC78524
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat