Antibodies
Anti-FOXP3 Antibody-Oligo Conjugate (ARC74142)
SKU: aoc2102
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FOXP3 Antibody (ARC74142)-IF1
Antibody Target
- Target
- Forkhead box protein P3
- UniProt Number
- Q9BZS1
- Target Description
- Transcriptional regulator which is crucial for the development and inhibitory function of regulatory T-cells (Treg) (PubMed:17377532, PubMed:21458306, PubMed:23947341, PubMed:24354325, PubMed:24722479, PubMed:24835996, PubMed:30513302, PubMed:32644293). Plays an essential role in maintaining homeostasis of the immune system by allowing the acquisition of full suppressive function and stability of the Treg lineage, and by directly modulating the expansion and function of conventional T-cells (PubMed:23169781). Can act either as a transcriptional repressor or a transcriptional activator depending on its interactions with other transcription factors, histone acetylases and deacetylases (PubMed:17377532, PubMed:21458306, PubMed:23947341, PubMed:24354325, PubMed:24722479). The suppressive activity of Treg involves the coordinate activation of many genes, including CTLA4 and TNFRSF18 by FOXP3 along with repression of genes encoding cytokines such as interleukin-2 (IL2) and interferon-gamma (IFNG) (PubMed:17377532, PubMed:21458306, PubMed:23947341, PubMed:24354325, PubMed:24722479). Inhibits cytokine production and T-cell effector function by repressing the activity of two key transcription factors, RELA and NFATC2 (PubMed:15790681). Mediates transcriptional repression of IL2 via its association with histone acetylase KAT5 and histone deacetylase HDAC7 (PubMed:17360565). Can activate the expression of TNFRSF18, IL2RA and CTLA4 and repress the expression of IL2 and IFNG via its association with transcription factor RUNX1 (PubMed:17377532). Inhibits the differentiation of IL17 producing helper T-cells (Th17) by antagonizing RORC function, leading to down-regulation of IL17 expression, favoring Treg development (PubMed:18368049). Inhibits the transcriptional activator activity of RORA (PubMed:18354202). Can repress the expression of IL2 and IFNG via its association with transcription factor IKZF4 (By similarity)..
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC74142
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse