Antibodies
Anti-Frataxin Antibody-Oligo Conjugate
SKU: aoc2106
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Frataxin Antibody-IF1
Antibody Target
- Target
- Frataxin, mitochondrial
- UniProt Number
- Q16595
- Target Description
- [Frataxin mature form]: Functions as an activator of persulfide transfer to the scaffoding protein ISCU as component of the core iron-sulfur cluster (ISC) assembly complex and participates to the [2Fe-2S] cluster assembly (PubMed:12785837, PubMed:24971490). Accelerates sulfur transfer from NFS1 persulfide intermediate to ISCU and to small thiols such as L-cysteine and glutathione leading to persulfuration of these thiols and ultimately sulfide release (PubMed:24971490). Binds ferrous ion and is released from FXN upon the addition of both L-cysteine and reduced FDX2 during [2Fe-2S] cluster assembly (PubMed:29576242). The core iron-sulfur cluster (ISC) assembly complex is involved in the de novo synthesis of a [2Fe-2S] cluster, the first step of the mitochondrial iron-sulfur protein biogenesis. This process is initiated by the cysteine desulfurase complex (NFS1:LYRM4:NDUFAB1) that produces persulfide which is delivered on the scaffold protein ISCU in a FXN-dependent manner. Then this complex is stabilized by FDX2 which provides reducing equivalents to accomplish the [2Fe-2S] cluster assembly. Finally, the [2Fe-2S] cluster is transferred from ISCU to chaperone proteins, including HSCB, HSPA9 and GLRX5 (By similarity). May play a role in the protection against iron-catalyzed oxidative stress through its ability to catalyze the oxidation of Fe(2+) to Fe(3+); the oligomeric form but not the monomeric form has in vitro ferroxidase activity (PubMed:15641778). May be able to store large amounts of iron in the form of a ferrihydrite mineral by oligomerization; however, the physiological relevance is unsure as reports are conflicting and the function has only been shown using heterologous overexpression systems (PubMed:11823441, PubMed:12755598). May function as an iron chaperone protein that protects the aconitase [4Fe-4S]2+ cluster from disassembly and promotes enzyme reactivation (PubMed:15247478). May play a role as a high affinity iron binding partner for FECH that is capable of both delivering iron to ferrochelatase and mediating the terminal step in mitochondrial heme biosynthesis (PubMed:15123683, PubMed:16239244)..; FUNCTION: [Extramitochondrial frataxin]: Modulates the RNA-binding activity of ACO1 (PubMed:20053667). May be involved in the cytoplasmic iron-sulfur protein biogenesis (PubMed:16091420). May contribute to oxidative stress resistance and overall cell survival (PubMed:16608849)..
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC66744
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat