Antibodies
Anti-FRS2 Antibody-Oligo Conjugate
SKU: aoc2107
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FRS2 Antibody-IF1
Antibody Target
- Target
- Fibroblast growth factor receptor substrate 2
- UniProt Number
- Q8WU20
- Target Description
- Adapter protein that links activated FGR and NGF receptors to downstream signaling pathways. Plays an important role in the activation of MAP kinases and in the phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, in response to ligand-mediated activation of FGFR1. Modulates signaling via SHC1 by competing for a common binding site on NTRK1..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC57138
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat