Antibodies
Anti-FSH alpha/beta Antibody-Oligo Conjugate
SKU: aoc2108
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FSH alpha/beta Antibody-IF1
Antibody Target
- Target
- Glycoprotein hormones alpha chain
- UniProt Number
- P01215
- Additional Target Information
- This antibody also binds Follitropin subunit beta, Uniprot:P01225.
- Target Description
- Shared alpha chain of the active heterodimeric glycoprotein hormones thyrotropin/thyroid stimulating hormone/TSH, lutropin/luteinizing hormone/LH, follitropin/follicle stimulating hormone/FSH and choriogonadotropin/CG. These hormones bind specific receptors on target cells that in turn activate downstream signaling pathways.
- Molecular Weight
- 13kDa/15kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC65860
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant fusion protein containing a sequence corresponding to amino acids 25-116 of human FSH alpha/beta(NP_000726.1/NP_000501.1).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human