Antibodies
Anti-FTO Antibody-Oligo Conjugate
SKU: aoc2110
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FTO Antibody-IF1
Antibody Target
- Target
- Alpha-ketoglutarate-dependent dioxygenase FTO
- UniProt Number
- Q9C0B1
- Target Description
- RNA demethylase that mediates oxidative demethylation of different RNA species, such as mRNAs, tRNAs and snRNAs, and acts as a regulator of fat mass, adipogenesis and energy homeostasis (PubMed:22002720, PubMed:25452335, PubMed:26457839, PubMed:26458103, PubMed:28002401, PubMed:30197295). Specifically demethylates N(6)-methyladenosine (m6A) RNA, the most prevalent internal modification of messenger RNA (mRNA) in higher eukaryotes (PubMed:22002720, PubMed:25452335, PubMed:26457839, PubMed:26458103, PubMed:30197295). M6A demethylation by FTO affects mRNA expression and stability (PubMed:30197295). Also able to demethylate m6A in U6 small nuclear RNA (snRNA) (PubMed:30197295). Mediates demethylation of N(6),2'-O-dimethyladenosine cap (m6A(m)), by demethylating the N(6)-methyladenosine at the second transcribed position of mRNAs and U6 snRNA (PubMed:28002401, PubMed:30197295). Demethylation of m6A(m) in the 5'-cap by FTO affects mRNA stability by promoting susceptibility to decapping (PubMed:28002401). Also acts as a tRNA demethylase by removing N(1)-methyladenine from various tRNAs (PubMed:30197295). Has no activity towards 1-methylguanine (PubMed:20376003). Has no detectable activity towards double-stranded DNA (PubMed:20376003). Also able to repair alkylated DNA and RNA by oxidative demethylation: demethylates single-stranded RNA containing 3-methyluracil, single-stranded DNA containing 3-methylthymine and has low demethylase activity towards single-stranded DNA containing 1-methyladenine or 3-methylcytosine (PubMed:18775698, PubMed:20376003). Ability to repair alkylated DNA and RNA is however unsure in vivo (PubMed:18775698, PubMed:20376003). Involved in the regulation of fat mass, adipogenesis and body weight, thereby contributing to the regulation of body size and body fat accumulation (PubMed:18775698, PubMed:20376003). Involved in the regulation of thermogenesis and the control of adipocyte differentiation into brown or white fat cells (PubMed:26287746). Regulates activity of the dopaminergic midbrain circuitry via its ability to demethylate m6A in mRNAs (By similarity). Plays an oncogenic role in a number of acute myeloid leukemias by enhancing leukemic oncogene-mediated cell transformation: acts by mediating m6A demethylation of target transcripts such as MYC, CEBPA, ASB2 and RARA, leading to promote their expression (PubMed:28017614, PubMed:29249359)..
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0851
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human