Antibodies
Anti-FTO Antibody-Oligo Conjugate
SKU: aoc2110
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FTO Antibody-IF1
Antibody Target
- Target
- Alpha-ketoglutarate-dependent dioxygenase FTO
- UniProt Number
- Q9C0B1
- Target Description
- RNA demethylase that mediates oxidative demethylation of different RNA species, such as mRNAs, tRNAs and snRNAs, and acts as a regulator of fat mass, adipogenesis and energy homeostasis. Specifically demethylates N(6)-methyladenosine (m6A) RNA, the most prevalent internal modification of messenger RNA (mRNA) in higher eukaryotes. M6A demethylation by FTO affects mRNA expression and stability. Also able to demethylate m6A in U6 small nuclear RNA (snRNA). Mediates demethylation of N(6),2'-O-dimethyladenosine cap (m6A(m)), by demethylating the N(6)-methyladenosine at the second transcribed position of mRNAs and U6 snRNA. Demethylation of m6A(m) in the 5'-cap by FTO affects mRNA stability by promoting susceptibility to decapping. Also acts as a tRNA demethylase by removing N(1)-methyladenine from various tRNAs. Has no activity towards 1-methylguanine. Has no detectable activity towards double-stranded DNA. Also able to repair alkylated DNA and RNA by oxidative demethylation: demethylates single-stranded RNA containing 3-methyluracil, single-stranded DNA containing 3-methylthymine and has low demethylase activity towards single-stranded DNA containing 1-methyladenine or 3-methylcytosine. Ability to repair alkylated DNA and RNA is however unsure in vivo. Involved in the regulation of fat mass, adipogenesis and body weight, thereby contributing to the regulation of body size and body fat accumulation. Involved in the regulation of thermogenesis and the control of adipocyte differentiation into brown or white fat cells. Regulates activity of the dopaminergic midbrain circuitry via its ability to demethylate m6A in mRNAs. Plays an oncogenic role in a number of acute myeloid leukemias by enhancing leukemic oncogene-mediated cell transformation: acts by mediating m6A demethylation of target transcripts such as MYC, CEBPA, ASB2 and RARA, leading to promote their expression.
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC0851
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human