Antibodies
Anti-Fukutin Antibody-Oligo Conjugate
SKU: aoc2112
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Fukutin Antibody-IF1
Antibody Target
- Target
- Ribitol-5-phosphate transferase FKTN
- UniProt Number
- O75072
- Target Description
- Catalyzes the transfer of a ribitol-phosphate from CDP-ribitol to the distal N-acetylgalactosamine of the phosphorylated O-mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1) (PubMed:26923585, PubMed:27194101, PubMed:29477842). This constitutes the first step in the formation of the ribitol 5-phosphate tandem repeat which links the phosphorylated O-mannosyl trisaccharide to the ligand binding moiety composed of repeats of 3-xylosyl-alpha-1,3-glucuronic acid-beta-1 (PubMed:17034757, PubMed:25279699, PubMed:26923585, PubMed:27194101, PubMed:29477842). Required for normal location of POMGNT1 in Golgi membranes, and for normal POMGNT1 activity (PubMed:17034757). May interact with and reinforce a large complex encompassing the outside and inside of muscle membranes (PubMed:25279699). Could be involved in brain development (Probable)..
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2559
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat