Antibodies
Anti-FUNDC1 Antibody-Oligo Conjugate
SKU: aoc2113
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-FUNDC1 Antibody-IF1
Antibody Target
- Target
- FUN14 domain-containing protein 1
- UniProt Number
- Q8IVP5
- Target Description
- Integral mitochondrial outer-membrane protein that mediates the formation of mitochondria-associated endoplasmic reticulum membranes (MAMs) (PubMed:33972548). In turn, mediates angiogenesis and neoangiogenesis through interference with intracellular Ca(2+) communication and regulation of the vascular endothelial growth factor receptor KDR/VEGFR2 expression at both mRNA and protein levels (PubMed:33972548). Also acts as an activator of hypoxia-induced mitophagy, an important mechanism for mitochondrial quality and homeostasis, by interacting with and recruiting LC3 protein family to mitochondria (PubMed:22267086, PubMed:24671035, PubMed:24746696, PubMed:27653272). Mechanistically, recruits DRP1 at ER-mitochondria contact sites leading to DRP1 oligomerization and GTPase activity to facilitate mitochondrial fission during hypoxia (PubMed:27145933, PubMed:33978709). Additionally, plays a role in hepatic ferroptosis by interacting directly with glutathione peroxidase/GPX4 to facilitate its recruitment into mitochondria through TOM/TIM complex where it is degraded by mitophagy (PubMed:36828120)..
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC74039
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat