Antibodies
Anti-G3BP1 Antibody-Oligo Conjugate
SKU: aoc2116
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-G3BP1 Antibody-IF1
Antibody Target
- Target
- Ras GTPase-activating protein-binding protein 1
- UniProt Number
- Q13283
- Target Description
- Protein involved in various processes, such as stress granule formation and innate immunity. Plays an essential role in stress granule formation. Stress granules are membraneless compartments that store mRNAs and proteins, such as stalled translation pre-initiation complexes, in response to stress. Promotes formation of stress granules phase-separated membraneless compartment by undergoing liquid-liquid phase separation (LLPS) upon unfolded RNA-binding: functions as a molecular switch that triggers RNA-dependent LLPS in response to a rise in intracellular free RNA concentrations. Also acts as an ATP- and magnesium-dependent helicase: unwinds DNA/DNA, RNA/DNA, and RNA/RNA substrates with comparable efficiency. Acts unidirectionally by moving in the 5' to 3' direction along the bound single-stranded DNA. Unwinds preferentially partial DNA and RNA duplexes having a 17 bp annealed portion and either a hanging 3' tail or hanging tails at both 5'- and 3'-ends. Plays an essential role in innate immunity by promoting CGAS and RIGI activity. Participates in the DNA-triggered cGAS/STING pathway by promoting the DNA binding and activation of CGAS. Triggers the condensation of cGAS, a process probably linked to the formation of membrane-less organelles. Also enhances RIGI-induced type I interferon production probably by helping RIGI at sensing pathogenic RNA. May also act as a phosphorylation-dependent sequence-specific endoribonuclease in vitro: Cleaves exclusively between cytosine and adenine and cleaves MYC mRNA preferentially at the 3'-UTR.
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0875
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat