Antibodies
Anti-G3BP1 Antibody-Oligo Conjugate
SKU: aoc2116
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-G3BP1 Antibody-IF1
Antibody Target
- Target
- Ras GTPase-activating protein-binding protein 1
- UniProt Number
- Q13283
- Target Description
- Protein involved in various processes, such as stress granule formation and innate immunity (PubMed:12642610, PubMed:20180778, PubMed:23279204, PubMed:30510222, PubMed:30804210). Plays an essential role in stress granule formation (PubMed:12642610, PubMed:20180778, PubMed:23279204, PubMed:32302570, PubMed:32302571, PubMed:32302572, PubMed:34739333, PubMed:35977029, PubMed:36183834, PubMed:36279435, PubMed:36692217, PubMed:37379838). Stress granules are membraneless compartments that store mRNAs and proteins, such as stalled translation pre-initiation complexes, in response to stress (PubMed:12642610, PubMed:20180778, PubMed:23279204, PubMed:27022092, PubMed:32302570, PubMed:32302571, PubMed:32302572, PubMed:36279435, PubMed:37379838). Promotes formation of stress granules phase-separated membraneless compartment by undergoing liquid-liquid phase separation (LLPS) upon unfolded RNA-binding: functions as a molecular switch that triggers RNA-dependent LLPS in response to a rise in intracellular free RNA concentrations (PubMed:32302570, PubMed:32302571, PubMed:32302572, PubMed:34739333, PubMed:36279435, PubMed:36692217). Also acts as an ATP- and magnesium-dependent helicase: unwinds DNA/DNA, RNA/DNA, and RNA/RNA substrates with comparable efficiency (PubMed:9889278). Acts unidirectionally by moving in the 5' to 3' direction along the bound single-stranded DNA (PubMed:9889278). Unwinds preferentially partial DNA and RNA duplexes having a 17 bp annealed portion and either a hanging 3' tail or hanging tails at both 5'- and 3'-ends (PubMed:9889278). Plays an essential role in innate immunity by promoting CGAS and RIGI activity (PubMed:30510222, PubMed:30804210). Participates in the DNA-triggered cGAS/STING pathway by promoting the DNA binding and activation of CGAS (PubMed:30510222). Triggers the condensation of cGAS, a process probably linked to the formation of membrane-less organelles (PubMed:34779554). Also enhances RIGI-induced type I interferon production probably by helping RIGI at sensing pathogenic RNA (PubMed:30804210). May also act as a phosphorylation-dependent sequence-specific endoribonuclease in vitro: Cleaves exclusively between cytosine and adenine and cleaves MYC mRNA preferentially at the 3'-UTR (PubMed:11604510)..
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0875
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat