AntibodiesNeuroMab
Anti-GABA-B-R1 Antibody-Oligo Conjugate
SKU: aoc10
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GABA-B-R1 Antibody-IF1
Antibody Target
- Target
- GABA B Receptor 1
- UniProt Number
- Q9UBS5
- Target Description
- Gamma-aminobutyric acid type B receptor subunit 1 or GABA BR1 is encoded by the gene GABBR1. GABA BR1 is a subunit of the G-protein coupled receptor for the neurotransmitter GABA (gamma-aminobutyric acid). It will inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters and the activity of ion channels and adenylyl cyclase. GABA BR1 is highly expressed in many tissues including eye, atrium, ventricle, lung and colon. In brain, wide expression is seen with high levels in the cerebral cortical layers and hippocampus. Cellularly, it is found at the cell junction, synapse, the postsynaptic cell membrane and cytoplasmic vesicle membrane. Diseases associated with GABBR1 include Temporal Lobe Epilepsy and Persistent Vegetative State.
- Molecular Weight
- 115 kDa
- Synonyms
- Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity against GABABR1
- Clone
- N93A/49
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 873-977 (cytoplasmic C-terminus) of rat GABABR1 (accession number Q9Z0U4) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- ChickenHumanMouseRabbitRat