Antibodies
Anti-Galectin 1 Antibody-Oligo Conjugate (ARC53156)
SKU: aoc2126
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Galectin 1 Antibody (ARC53156)-IF1
Antibody Target
- Target
- Galectin-1
- UniProt Number
- P09382
- Target Description
- Lectin that binds beta-galactoside and a wide array of complex carbohydrates. Plays a role in regulating apoptosis, cell proliferation and cell differentiation. Inhibits CD45 protein phosphatase activity and therefore the dephosphorylation of Lyn kinase. Strong inducer of T-cell apoptosis. Plays a negative role in Th17 cell differentiation via activation of the receptor CD69.
- Molecular Weight
- 15kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53156
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat