Antibodies
Anti-Galectin 3 Antibody-Oligo Conjugate (ARC58277)
SKU: aoc2129
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Galectin 3 Antibody (ARC58277)-IF1
Antibody Target
- Target
- Galectin-3
- UniProt Number
- P17931
- Target Description
- Galactose-specific lectin which binds IgE. May mediate with the alpha-3, beta-1 integrin the stimulation by CSPG4 of endothelial cells migration. Together with DMBT1, required for terminal differentiation of columnar epithelial cells during early embryogenesis. In the nucleus: acts as a pre-mRNA splicing factor. Involved in acute inflammatory responses including neutrophil activation and adhesion, chemoattraction of monocytes macrophages, opsonization of apoptotic neutrophils, and activation of mast cells. Together with TRIM16, coordinates the recognition of membrane damage with mobilization of the core autophagy regulators ATG16L1 and BECN1 in response to damaged endomembranes.
- Molecular Weight
- 26kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC58277
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat