Antibodies
Anti-gamma Adaptin Antibody-Oligo Conjugate
SKU: aoc2132
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-gamma Adaptin Antibody-IF1
Antibody Target
- Target
- AP-1 complex subunit gamma-1
- UniProt Number
- O43747
- Target Description
- Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules. In association with AFTPH/aftiphilin in the aftiphilin/p200/gamma-synergin complex, involved in the trafficking of transferrin from early to recycling endosomes, and the membrane trafficking of furin and the lysosomal enzyme cathepsin D between the trans-Golgi network (TGN) and endosomes.
- Molecular Weight
- 91kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2440
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat