Antibodies
Anti-GAPDH Antibody-Oligo Conjugate (ARC50888)
SKU: aoc1004
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GAPDH Antibody (ARC50888)-IF1
Antibody Target
- Target
- Glyceraldehyde-3-phosphate dehydrogenase
- UniProt Number
- P04406
- Target Description
- Has both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities, thereby playing a role in glycolysis and nuclear functions, respectively (PubMed:11724794, PubMed:3170585). Glyceraldehyde-3-phosphate dehydrogenase is a key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate (PubMed:11724794, PubMed:3170585). Modulates the organization and assembly of the cytoskeleton (By similarity). Facilitates the CHP1-dependent microtubule and membrane associations through its ability to stimulate the binding of CHP1 to microtubules (By similarity). Component of the GAIT (gamma interferon-activated inhibitor of translation) complex which mediates interferon-gamma-induced transcript-selective translation inhibition in inflammation processes (PubMed:23071094). Upon interferon-gamma treatment assembles into the GAIT complex which binds to stem loop-containing GAIT elements in the 3'-UTR of diverse inflammatory mRNAs (such as ceruplasmin) and suppresses their translation (PubMed:23071094). Also plays a role in innate immunity by promoting TNF-induced NF-kappa-B activation and type I interferon production, via interaction with TRAF2 and TRAF3, respectively (PubMed:23332158, PubMed:27387501). Participates in nuclear events including transcription, RNA transport, DNA replication and apoptosis (By similarity). Nuclear functions are probably due to the nitrosylase activity that mediates cysteine S-nitrosylation of nuclear target proteins such as SIRT1, HDAC2 and PRKDC (By similarity)..
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC50888
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat