Antibodies
Anti-GAPDH Antibody-Oligo Conjugate (ARC50888)
SKU: aoc1004
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GAPDH Antibody (ARC50888)-IF1
Antibody Target
- Target
- Glyceraldehyde-3-phosphate dehydrogenase
- UniProt Number
- P04406
- Target Description
- Has both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities, thereby playing a role in glycolysis and nuclear functions, respectively. Glyceraldehyde-3-phosphate dehydrogenase is a key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Modulates the organization and assembly of the cytoskeleton. Facilitates the CHP1-dependent microtubule and membrane associations through its ability to stimulate the binding of CHP1 to microtubules. Component of the GAIT (gamma interferon-activated inhibitor of translation) complex which mediates interferon-gamma-induced transcript-selective translation inhibition in inflammation processes. Upon interferon-gamma treatment assembles into the GAIT complex which binds to stem loop-containing GAIT elements in the 3'-UTR of diverse inflammatory mRNAs (such as ceruplasmin) and suppresses their translation. Also plays a role in innate immunity by promoting TNF-induced NF-kappa-B activation and type I interferon production, via interaction with TRAF2 and TRAF3, respectively. Participates in nuclear events including transcription, RNA transport, DNA replication and apoptosis. Nuclear functions are probably due to the nitrosylase activity that mediates cysteine S-nitrosylation of nuclear target proteins such as SIRT1, HDAC2 and PRKDC.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC50888
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat