Antibodies
Anti-GATA3 Antibody-Oligo Conjugate (ARC0115)
SKU: aoc2140
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-GATA3 Antibody (ARC0115)-PLA1
Antibody Target
- Target
- Trans-acting T-cell-specific transcription factor GATA-3
- UniProt Number
- P23771
- Target Description
- Transcriptional activator which binds to the enhancer of the T-cell receptor alpha and delta genes. Binds to the consensus sequence 5'-AGATAG-3'. Required for the T-helper 2 (Th2) differentiation process following immune and inflammatory responses. Positively regulates ASB2 expression. Coordinates macrophage transcriptional activation and UCP2-dependent metabolic reprogramming in response to IL33. Upon tissue injury, acts downstream of IL33 signaling to drive differentiation of inflammation-resolving alternatively activated macrophages.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISAChIPChIP-seq
- Clone
- ARC0115
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse