Antibodies
Anti-GATA3 Antibody-Oligo Conjugate (ARC67910)
SKU: aoc2141
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GATA3 Antibody (ARC67910)-IF1
Antibody Target
- Target
- Trans-acting T-cell-specific transcription factor GATA-3
- UniProt Number
- P23771
- Target Description
- Transcriptional activator which binds to the enhancer of the T-cell receptor alpha and delta genes. Binds to the consensus sequence 5'-AGATAG-3'. Required for the T-helper 2 (Th2) differentiation process following immune and inflammatory responses. Positively regulates ASB2 expression (By similarity). Coordinates macrophage transcriptional activation and UCP2-dependent metabolic reprogramming in response to IL33. Upon tissue injury, acts downstream of IL33 signaling to drive differentiation of inflammation-resolving alternatively activated macrophages..
- Molecular Weight
- 48 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PFC (intra)ELISA
- Clone
- ARC67910
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human