Antibodies
Anti-GATA4 Antibody-Oligo Conjugate
SKU: aoc2142
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GATA4 Antibody-IF1
Antibody Target
- Target
- Transcription factor GATA-4
- UniProt Number
- P43694
- Target Description
- Transcriptional activator that binds to the consensus sequence 5'-AGATAG-3' and plays a key role in cardiac development and function (PubMed:24000169, PubMed:27984724, PubMed:35182466). In cooperation with TBX5, it binds to cardiac super-enhancers and promotes cardiomyocyte gene expression, while it down-regulates endocardial and endothelial gene expression (PubMed:27984724). Involved in bone morphogenetic protein (BMP)-mediated induction of cardiac-specific gene expression. Binds to BMP response element (BMPRE) DNA sequences within cardiac activating regions (By similarity). Acts as a transcriptional activator of ANF in cooperation with NKX2-5 (By similarity). Promotes cardiac myocyte enlargement (PubMed:20081228). Required during testicular development (PubMed:21220346). May play a role in sphingolipid signaling by regulating the expression of sphingosine-1-phosphate degrading enzyme, sphingosine-1-phosphate lyase (PubMed:15734735)..
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC51718
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat