Antibodies
Anti-GATA4 Antibody-Oligo Conjugate
SKU: aoc2142
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GATA4 Antibody-IF1
Antibody Target
- Target
- Transcription factor GATA-4
- UniProt Number
- P43694
- Target Description
- Transcriptional activator that binds to the consensus sequence 5'-AGATAG-3' and plays a key role in cardiac development and function. In cooperation with TBX5, it binds to cardiac super-enhancers and promotes cardiomyocyte gene expression, while it down-regulates endocardial and endothelial gene expression. Involved in bone morphogenetic protein (BMP)-mediated induction of cardiac-specific gene expression. Binds to BMP response element (BMPRE) DNA sequences within cardiac activating regions. Acts as a transcriptional activator of ANF in cooperation with NKX2-5. Promotes cardiac myocyte enlargement. Required during testicular development. May play a role in sphingolipid signaling by regulating the expression of sphingosine-1-phosphate degrading enzyme, sphingosine-1-phosphate lyase.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC51718
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat