Antibodies
Anti-GATM Antibody-Oligo Conjugate
SKU: aoc2143
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GATM Antibody-IF1
Antibody Target
- Target
- Glycine amidinotransferase, mitochondrial
- UniProt Number
- P50440
- Target Description
- Transamidinase that catalyzes the transfer of the amidino group of L-arginine onto the amino moiety of acceptor metabolites such as glycine, beta-alanine, gamma-aminobutyric acid (GABA) and taurine yielding the corresponding guanidine derivatives. Catalyzes the rate-limiting step of creatine biosynthesis, namely the transfer of the amidino group from L-arginine to glycine to generate guanidinoacetate, which is then methylated by GAMT to form creatine. Provides creatine as a source for ATP generation in tissues with high energy demands, in particular skeletal muscle, heart and brain (Probable).
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC65368
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat