Antibodies
Anti-GCN2 Antibody-Oligo Conjugate
SKU: aoc2150
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GCN2 Antibody-IF1
Antibody Target
- Target
- eIF-2-alpha kinase GCN2
- UniProt Number
- Q9P2K8
- Target Description
- Metabolic-stress sensing protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (EIF2S1/eIF-2-alpha) in response to low amino acid availability. Plays a role as an activator of the integrated stress response (ISR) required for adaptation to amino acid starvation. EIF2S1/eIF-2-alpha phosphorylation in response to stress converts EIF2S1/eIF-2-alpha into a global protein synthesis inhibitor, leading to a global attenuation of cap-dependent translation, and thus to a reduced overall utilization of amino acids, while concomitantly initiating the preferential translation of ISR-specific mRNAs, such as the transcriptional activator ATF4, and hence allowing ATF4-mediated reprogramming of amino acid biosynthetic gene expression to alleviate nutrient depletion. Binds uncharged tRNAs. Required for the translational induction of protein kinase PRKCH following amino acid starvation. Involved in cell cycle arrest by promoting cyclin D1 mRNA translation repression after the unfolded protein response pathway (UPR) activation or cell cycle inhibitor CDKN1A/p21 mRNA translation activation in response to amino acid deprivation. Plays a role in the consolidation of synaptic plasticity, learning as well as formation of long-term memory. Plays a role in neurite outgrowth inhibition. Plays a proapoptotic role in response to glucose deprivation. Promotes global cellular protein synthesis repression in response to UV irradiation independently of the stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) and p38 MAPK signaling pathways. Plays a role in the antiviral response against alphavirus infection; impairs early viral mRNA translation of the incoming genomic virus RNA, thus preventing alphavirus replication.; FUNCTION: (Microbial infection) Plays a role in modulating the adaptive immune response to yellow fever virus infection; promotes dendritic cells to initiate autophagy and antigene presentation to both CD4(+) and CD8(+) T-cells under amino acid starvation.
- Molecular Weight
- 187kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52336
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat