Antibodies
Anti-GDNF Receptor alpha 1/GFRA1 Antibody-Oligo Conjugate
SKU: aoc2154
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GDNF Receptor alpha 1/GFRA1 Antibody-IF1
Antibody Target
- Target
- GDNF family receptor alpha-1
- UniProt Number
- P56159
- Target Description
- Coreceptor for GDNF, a neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake (PubMed:10829012, PubMed:31535977). GDNF-binding leads to autophosphorylation and activation of the RET receptor (PubMed:31535977)..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ICCIF-PELISA
- Clone
- ARC59643
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat