Antibodies
Anti-Gemin 2 Antibody-Oligo Conjugate
SKU: aoc2157
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Gemin 2 Antibody-IF1
Antibody Target
- Target
- Gem-associated protein 2
- UniProt Number
- O14893
- Target Description
- The SMN complex catalyzes the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome, and thereby plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP (Sm core). In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG (5Sm) are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. To assemble core snRNPs, the SMN complex accepts the trapped 5Sm proteins from CLNS1A. Binding of snRNA inside 5Sm ultimately triggers eviction of the SMN complex, thereby allowing binding of SNRPD3 and SNRPB to complete assembly of the core snRNP. Within the SMN complex, GEMIN2 constrains the conformation of 5Sm, thereby promoting 5Sm binding to snRNA containing the snRNP code (a nonameric Sm site and a 3'-adjacent stem-loop), thus preventing progression of assembly until a cognate substrate is bound.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2419
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat