Antibodies
Anti-Gemin 2 Antibody-Oligo Conjugate
SKU: aoc2157
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Gemin 2 Antibody-IF1
Antibody Target
- Target
- Gem-associated protein 2
- UniProt Number
- O14893
- Target Description
- The SMN complex catalyzes the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome, and thereby plays an important role in the splicing of cellular pre-mRNAs (PubMed:18984161, PubMed:9323129). Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP (Sm core) (PubMed:18984161). In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG (5Sm) are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP (PubMed:18984161). To assemble core snRNPs, the SMN complex accepts the trapped 5Sm proteins from CLNS1A (PubMed:18984161, PubMed:9323129). Binding of snRNA inside 5Sm ultimately triggers eviction of the SMN complex, thereby allowing binding of SNRPD3 and SNRPB to complete assembly of the core snRNP (PubMed:31799625). Within the SMN complex, GEMIN2 constrains the conformation of 5Sm, thereby promoting 5Sm binding to snRNA containing the snRNP code (a nonameric Sm site and a 3'-adjacent stem-loop), thus preventing progression of assembly until a cognate substrate is bound (PubMed:16314521, PubMed:21816274, PubMed:31799625)..
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2419
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat