Antibodies
Anti-Geminin Antibody-Oligo Conjugate
SKU: aoc2158
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Geminin Antibody-IF1
Antibody Target
- Target
- Geminin
- UniProt Number
- O75496
- Target Description
- Inhibits DNA replication by preventing the incorporation of MCM complex into pre-replication complex (pre-RC) (PubMed:14993212, PubMed:20129055, PubMed:24064211, PubMed:9635433). It is degraded during the mitotic phase of the cell cycle (PubMed:14993212, PubMed:24064211, PubMed:9635433). Its destruction at the metaphase-anaphase transition permits replication in the succeeding cell cycle (PubMed:14993212, PubMed:24064211, PubMed:9635433). Inhibits histone acetyltransferase activity of KAT7/HBO1 in a CDT1-dependent manner, inhibiting histone H4 acetylation and DNA replication licensing (PubMed:20129055). Inhibits the transcriptional activity of a subset of Hox proteins, enrolling them in cell proliferative control (PubMed:22615398)..
- Molecular Weight
- 24kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC65833
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse