AntibodiesNeuroMab
Anti-GFAP Antibody-Oligo Conjugate
SKU: aoc23
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GFAP Antibody-IF1
Antibody Target
- Target
- GFAP
- UniProt Number
- P14136
- Target Description
- Glial fibrillary acidic protein (GFAP) is an intermediate filament with many different isoforms, and acts as a structural protein in the cytoskeleton. It is expressed in astrocytes in brain and is often used as an astrocyte marker. GFAP is belived to be involved in many CNS processes including cell communication and mitosis. GFAP has been found to be involved in Alexander disease and Wernicke's encephalopathy.
- Molecular Weight
- 50 kDa
- Synonyms
- Glial fibrillary acidic protein (GFAP)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- Cross-reacts with GFAP-R416W and other GFAP mutant proteinsDoes not cross-react with other proteins (based on KO validation results)
- Clone
- N206A/8
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide amino acids 411-422 (KTVEMRDGEVIK) of human GFAP (accession number P14136)
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- DrosophilaGuinea PigHumanMonkey (Non-Human Primate)MousePolar BearRat