Antibodies
Anti-GLDC Antibody-Oligo Conjugate (ARC66832)
SKU: aoc2165
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GLDC Antibody (ARC66832)-IF1
Antibody Target
- Target
- Glycine dehydrogenase
- UniProt Number
- P23378
- Target Description
- The glycine cleavage system catalyzes the degradation of glycine. The P protein (GLDC) binds the alpha-amino group of glycine through its pyridoxal phosphate cofactor; CO(2) is released and the remaining methylamine moiety is then transferred to the lipoamide cofactor of the H protein (GCSH).
- Molecular Weight
- 113kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC66832
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat