Antibodies
Anti-GLI1 Antibody-Oligo Conjugate
SKU: aoc2166
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GLI1 Antibody-IF1
Antibody Target
- Target
- Zinc finger protein GLI1
- UniProt Number
- P08151
- Target Description
- Acts as a transcriptional activator (PubMed:10806483, PubMed:19706761, PubMed:19878745, PubMed:24076122, PubMed:24217340, PubMed:24311597). Binds to the DNA consensus sequence 5'-GACCACCCA-3' (PubMed:2105456, PubMed:24217340, PubMed:8378770). Regulates the transcription of specific genes during normal development (PubMed:19706761). Plays a role in craniofacial development and digital development, as well as development of the central nervous system and gastrointestinal tract. Mediates SHH signaling (PubMed:19706761, PubMed:28973407). Plays a role in cell proliferation and differentiation via its role in SHH signaling (PubMed:11238441, PubMed:28973407)..; FUNCTION: [Isoform 2]: Acts as a transcriptional activator, but activates a different set of genes than isoform 1. Activates expression of CD24, unlike isoform 1. Mediates SHH signaling. Promotes cancer cell migration..
- Molecular Weight
- 118kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC59108
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat