Antibodies
Anti-GLI2 Antibody-Oligo Conjugate
SKU: aoc2167
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GLI2 Antibody-IF1
Antibody Target
- Target
- Zinc finger protein GLI2
- UniProt Number
- P10070
- Target Description
- Functions as a transcription regulator in the hedgehog (Hh) pathway. Functions as a transcriptional activator. May also function as transcriptional repressor. Requires STK36 for full transcriptional activator activity. Required for normal embryonic development.; FUNCTION: [Isoform 1]: Involved in the smoothened (SHH) signaling pathway.; FUNCTION: [Isoform 2]: Involved in the smoothened (SHH) signaling pathway.; FUNCTION: [Isoform 3]: Involved in the smoothened (SHH) signaling pathway.; FUNCTION: [Isoform 4]: Involved in the smoothened (SHH) signaling pathway.; FUNCTION: [Isoform 1]: Acts as a transcriptional activator in T-cell leukemia virus type 1 (HTLV-1)-infected cells in a Tax-dependent manner. Binds to the DNA sequence 5'-GAACCACCCA-3' which is part of the Tax-responsive element (TRE-2S) regulatory element that augments the Tax-dependent enhancer of HTLV-1.; FUNCTION: [Isoform 2]: (Microbial infection) Acts as a transcriptional activators in T-cell leukemia virus type 1 (HTLV-1)-infected cells in a Tax-dependent manner. Binds to the DNA sequence 5'-GAACCACCCA-3' which is part of the Tax-responsive element (TRE-2S) regulatory element that augments the Tax-dependent enhancer of HTLV-1.; FUNCTION: [Isoform 3]: (Microbial infection) Acts as a transcriptional activators in T-cell leukemia virus type 1 (HTLV-1)-infected cells in a Tax-dependent manner. Binds to the DNA sequence 5'-GAACCACCCA-3' which is part of the Tax-responsive element (TRE-2S) regulatory element that augments the Tax-dependent enhancer of HTLV-1.; FUNCTION: [Isoform 4]: (Microbial infection) Acts as a transcriptional activators in T-cell leukemia virus type 1 (HTLV-1)-infected cells in a Tax-dependent manner. Binds to the DNA sequence 5'-GAACCACCCA-3' which is part of the Tax-responsive element (TRE-2S) regulatory element that augments the Tax-dependent enhancer of HTLV-1.; FUNCTION: [Isoform 5]: Acts as a transcriptional repressor.
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ICCIF-PIHCELISA
- Clone
- ARC58878
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat