Antibodies
Anti-GLI3 Antibody-Oligo Conjugate
SKU: aoc2168
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GLI3 Antibody-IF1
Antibody Target
- Target
- Transcriptional activator GLI3
- UniProt Number
- P10071
- Target Description
- Has a dual function as a transcriptional activator and a repressor of the sonic hedgehog (Shh) pathway, and plays a role in limb development. The full-length GLI3 form (GLI3FL) after phosphorylation and nuclear translocation, acts as an activator (GLI3A) while GLI3R, its C-terminally truncated form, acts as a repressor. A proper balance between the GLI3 activator and the repressor GLI3R, rather than the repressor gradient itself or the activator/repressor ratio gradient, specifies limb digit number and identity. In concert with TRPS1, plays a role in regulating the size of the zone of distal chondrocytes, in restricting the zone of PTHLH expression in distal cells and in activating chondrocyte proliferation. Binds to the minimal GLI-consensus sequence 5'-GGGTGGTC-3'.
- Molecular Weight
- 170kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1941
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat