Antibodies
Anti-Glicentin Antibody-Oligo Conjugate (ARC56936)
SKU: aoc2172
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Glicentin Antibody (ARC56936)-IF1
Antibody Target
- Target
- Pro-glucagon [Cleaved into: Glicentin; Glicentin-related polypeptide
- UniProt Number
- P01275
- Target Description
- [Glucagon]: Plays a key role in glucose metabolism and homeostasis. Regulates blood glucose by increasing gluconeogenesis and decreasing glycolysis. A counterregulatory hormone of insulin, raises plasma glucose levels in response to insulin-induced hypoglycemia. Plays an important role in initiating and maintaining hyperglycemic conditions in diabetes..; FUNCTION: [Glucagon-like peptide 1]: Potent stimulator of glucose-dependent insulin release. Also stimulates insulin release in response to IL6 (PubMed:22037645). Plays important roles on gastric motility and the suppression of plasma glucagon levels. May be involved in the suppression of satiety and stimulation of glucose disposal in peripheral tissues, independent of the actions of insulin. Has growth-promoting activities on intestinal epithelium. May also regulate the hypothalamic pituitary axis (HPA) via effects on LH, TSH, CRH, oxytocin, and vasopressin secretion. Increases islet mass through stimulation of islet neogenesis and pancreatic beta cell proliferation. Inhibits beta cell apoptosis (Probable)..; FUNCTION: [Glucagon-like peptide 2]: Stimulates intestinal growth and up-regulates villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. The gastrointestinal tract, from the stomach to the colon is the principal target for GLP-2 action. Plays a key role in nutrient homeostasis, enhancing nutrient assimilation through enhanced gastrointestinal function, as well as increasing nutrient disposal. Stimulates intestinal glucose transport and decreases mucosal permeability..; FUNCTION: [Oxyntomodulin]: Significantly reduces food intake. Inhibits gastric emptying in humans. Suppression of gastric emptying may lead to increased gastric distension, which may contribute to satiety by causing a sensation of fullness..; FUNCTION: [Glicentin]: May modulate gastric acid secretion and the gastro-pyloro-duodenal activity. May play an important role in intestinal mucosal growth in the early period of life..
- Molecular Weight
- 21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IF-PIHCELISA
- Clone
- ARC56936
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat