AntibodiesNeuroMab
Anti-GluA1/GluR1 Glutamate Receptor Antibody-Oligo Conjugate
SKU: aoc24
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GluA1/GluR1 Glutamate Receptor Antibody-IF1
Antibody Target
- Target
- GluA1/GluR1 glutamate receptor
- UniProt Number
- P42261
- Target Description
- Glutamate receptor 1 or GluA1/GluR1 glutamate receptor is a member of the glutamate-gated ion channel family. GluR1 funcitons as an excitatory neurotransmitter at many synapses in the central nervous system and is widely expressed in brain. Mutations in the GluR1 gene are associated with cerebral cortical dysplasia, Status Epilepticus, and depression.
- Molecular Weight
- 100 kDa
- Synonyms
- Glutamate receptor 1 (GluR-1) (AMPA-selective glutamate receptor 1) (GluR-A) (GluR-K1) (Glutamate receptor ionotropic, AMPA 1) (GluA1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- Does not cross-react with GluR2
- Clone
- N355/1
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1-389 (extracellular N-terminus) of rat GluA1/GluR1 (accession number P19490) produced recombinantly in E. Coli.
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat