Antibodies
Anti-Glucocorticoid Receptor Antibody-Oligo Conjugate
SKU: aoc2175
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Glucocorticoid Receptor Antibody-PLA1
Antibody Target
- Target
- Glucocorticoid receptor
- UniProt Number
- P04150
- Target Description
- Receptor for glucocorticoids (GC). Has a dual mode of action: as a transcription factor that binds to glucocorticoid response elements (GRE), both for nuclear and mitochondrial DNA, and as a modulator of other transcription factors. Affects inflammatory responses, cellular proliferation and differentiation in target tissues. Involved in chromatin remodeling. Plays a role in rapid mRNA degradation by binding to the 5' UTR of target mRNAs and interacting with PNRC2 in a ligand-dependent manner which recruits the RNA helicase UPF1 and the mRNA-decapping enzyme DCP1A, leading to RNA decay. Could act as a coactivator for STAT5-dependent transcription upon growth hormone (GH) stimulation and could reveal an essential role of hepatic GR in the control of body growth.; FUNCTION: [Isoform Alpha]: Has transcriptional activation and repression activity. Mediates glucocorticoid-induced apoptosis. Promotes accurate chromosome segregation during mitosis. May act as a tumor suppressor. May play a negative role in adipogenesis through the regulation of lipolytic and antilipogenic gene expression.; FUNCTION: [Isoform Beta]: Acts as a dominant negative inhibitor of isoform Alpha. Has intrinsic transcriptional activity independent of isoform Alpha when both isoforms are coexpressed. Loses this transcription modulator function on its own. Has no hormone-binding activity. May play a role in controlling glucose metabolism by maintaining insulin sensitivity. Reduces hepatic gluconeogenesis through down-regulation of PEPCK in an isoform Alpha-dependent manner. Directly regulates STAT1 expression in isoform Alpha-independent manner.; FUNCTION: [Isoform Alpha-2]: Has lower transcriptional activation activity than isoform Alpha. Exerts a dominant negative effect on isoform Alpha trans-repression mechanism.; FUNCTION: [Isoform GR-P]: Increases activity of isoform Alpha.; FUNCTION: [Isoform Alpha-B]: More effective than isoform Alpha in transcriptional activation, but not repression activity.; FUNCTION: [Isoform 10]: Has transcriptional activation activity.; FUNCTION: [Isoform Alpha-C1]: Has transcriptional activation activity.; FUNCTION: [Isoform Alpha-C2]: Has transcriptional activation activity.; FUNCTION: [Isoform Alpha-C3]: Has highest transcriptional activation activity of all isoforms created by alternative initiation. Has transcriptional repression activity. Mediates glucocorticoid-induced apoptosis.; FUNCTION: [Isoform Alpha-D1]: Has transcriptional activation activity.; FUNCTION: [Isoform Alpha-D2]: Has transcriptional activation activity.; FUNCTION: [Isoform Alpha-D3]: Has lowest transcriptional activation activity of all isoforms created by alternative initiation. Has transcriptional repression activity.
- Molecular Weight
- 86kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0062
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat