Antibodies

Anti-Glucocorticoid Receptor Antibody-Oligo Conjugate

SKU: aoc2175

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Proximity Ligation Assay Oligossee protocol

PLA1 Oligo Details

5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'

View Paper

An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.

Anti-Glucocorticoid Receptor Antibody-PLA1

Antibody Target

Target
Glucocorticoid receptor
UniProt Number
P04150
Target Description
Receptor for glucocorticoids (GC) (PubMed:27120390, PubMed:37478846). Has a dual mode of action: as a transcription factor that binds to glucocorticoid response elements (GRE), both for nuclear and mitochondrial DNA, and as a modulator of other transcription factors (PubMed:28139699). Affects inflammatory responses, cellular proliferation and differentiation in target tissues. Involved in chromatin remodeling (PubMed:9590696). Plays a role in rapid mRNA degradation by binding to the 5' UTR of target mRNAs and interacting with PNRC2 in a ligand-dependent manner which recruits the RNA helicase UPF1 and the mRNA-decapping enzyme DCP1A, leading to RNA decay (PubMed:25775514). Could act as a coactivator for STAT5-dependent transcription upon growth hormone (GH) stimulation and could reveal an essential role of hepatic GR in the control of body growth (By similarity)..; FUNCTION: [Isoform Alpha]: Has transcriptional activation and repression activity (PubMed:11435610, PubMed:15769988, PubMed:15866175, PubMed:17635946, PubMed:19141540, PubMed:19248771, PubMed:20484466, PubMed:21664385, PubMed:23820903). Mediates glucocorticoid-induced apoptosis (PubMed:23303127). Promotes accurate chromosome segregation during mitosis (PubMed:25847991). May act as a tumor suppressor (PubMed:25847991). May play a negative role in adipogenesis through the regulation of lipolytic and antilipogenic gene expression (By similarity)..; FUNCTION: [Isoform Beta]: Acts as a dominant negative inhibitor of isoform Alpha (PubMed:20484466, PubMed:7769088, PubMed:8621628). Has intrinsic transcriptional activity independent of isoform Alpha when both isoforms are coexpressed (PubMed:19248771, PubMed:26711253). Loses this transcription modulator function on its own (PubMed:20484466). Has no hormone-binding activity (PubMed:8621628). May play a role in controlling glucose metabolism by maintaining insulin sensitivity (By similarity). Reduces hepatic gluconeogenesis through down-regulation of PEPCK in an isoform Alpha-dependent manner (PubMed:26711253). Directly regulates STAT1 expression in isoform Alpha-independent manner (PubMed:26711253)..; FUNCTION: [Isoform Alpha-2]: Has lower transcriptional activation activity than isoform Alpha. Exerts a dominant negative effect on isoform Alpha trans-repression mechanism (PubMed:20484466).; FUNCTION: [Isoform GR-P]: Increases activity of isoform Alpha..; FUNCTION: [Isoform Alpha-B]: More effective than isoform Alpha in transcriptional activation, but not repression activity..; FUNCTION: [Isoform 10]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-C1]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-C2]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-C3]: Has highest transcriptional activation activity of all isoforms created by alternative initiation (PubMed:15866175, PubMed:23820903). Has transcriptional repression activity (PubMed:23303127). Mediates glucocorticoid-induced apoptosis (PubMed:23303127, PubMed:23820903)..; FUNCTION: [Isoform Alpha-D1]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-D2]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-D3]: Has lowest transcriptional activation activity of all isoforms created by alternative initiation (PubMed:15866175, PubMed:23820903). Has transcriptional repression activity (PubMed:23303127)..
Molecular Weight
86kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIPELISA
Clone
ARC0062
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat