Antibodies
Anti-Glucocorticoid Receptor Antibody-Oligo Conjugate
SKU: aoc2175
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Glucocorticoid Receptor Antibody-PLA1
Antibody Target
- Target
- Glucocorticoid receptor
- UniProt Number
- P04150
- Target Description
- Receptor for glucocorticoids (GC) (PubMed:27120390, PubMed:37478846). Has a dual mode of action: as a transcription factor that binds to glucocorticoid response elements (GRE), both for nuclear and mitochondrial DNA, and as a modulator of other transcription factors (PubMed:28139699). Affects inflammatory responses, cellular proliferation and differentiation in target tissues. Involved in chromatin remodeling (PubMed:9590696). Plays a role in rapid mRNA degradation by binding to the 5' UTR of target mRNAs and interacting with PNRC2 in a ligand-dependent manner which recruits the RNA helicase UPF1 and the mRNA-decapping enzyme DCP1A, leading to RNA decay (PubMed:25775514). Could act as a coactivator for STAT5-dependent transcription upon growth hormone (GH) stimulation and could reveal an essential role of hepatic GR in the control of body growth (By similarity)..; FUNCTION: [Isoform Alpha]: Has transcriptional activation and repression activity (PubMed:11435610, PubMed:15769988, PubMed:15866175, PubMed:17635946, PubMed:19141540, PubMed:19248771, PubMed:20484466, PubMed:21664385, PubMed:23820903). Mediates glucocorticoid-induced apoptosis (PubMed:23303127). Promotes accurate chromosome segregation during mitosis (PubMed:25847991). May act as a tumor suppressor (PubMed:25847991). May play a negative role in adipogenesis through the regulation of lipolytic and antilipogenic gene expression (By similarity)..; FUNCTION: [Isoform Beta]: Acts as a dominant negative inhibitor of isoform Alpha (PubMed:20484466, PubMed:7769088, PubMed:8621628). Has intrinsic transcriptional activity independent of isoform Alpha when both isoforms are coexpressed (PubMed:19248771, PubMed:26711253). Loses this transcription modulator function on its own (PubMed:20484466). Has no hormone-binding activity (PubMed:8621628). May play a role in controlling glucose metabolism by maintaining insulin sensitivity (By similarity). Reduces hepatic gluconeogenesis through down-regulation of PEPCK in an isoform Alpha-dependent manner (PubMed:26711253). Directly regulates STAT1 expression in isoform Alpha-independent manner (PubMed:26711253)..; FUNCTION: [Isoform Alpha-2]: Has lower transcriptional activation activity than isoform Alpha. Exerts a dominant negative effect on isoform Alpha trans-repression mechanism (PubMed:20484466).; FUNCTION: [Isoform GR-P]: Increases activity of isoform Alpha..; FUNCTION: [Isoform Alpha-B]: More effective than isoform Alpha in transcriptional activation, but not repression activity..; FUNCTION: [Isoform 10]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-C1]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-C2]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-C3]: Has highest transcriptional activation activity of all isoforms created by alternative initiation (PubMed:15866175, PubMed:23820903). Has transcriptional repression activity (PubMed:23303127). Mediates glucocorticoid-induced apoptosis (PubMed:23303127, PubMed:23820903)..; FUNCTION: [Isoform Alpha-D1]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-D2]: Has transcriptional activation activity..; FUNCTION: [Isoform Alpha-D3]: Has lowest transcriptional activation activity of all isoforms created by alternative initiation (PubMed:15866175, PubMed:23820903). Has transcriptional repression activity (PubMed:23303127)..
- Molecular Weight
- 86kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0062
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat