Antibodies
Anti-GLUD1 Antibody-Oligo Conjugate
SKU: aoc2176
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GLUD1 Antibody-IF1
Antibody Target
- Target
- Glutamate dehydrogenase 1, mitochondrial
- UniProt Number
- P00367
- Target Description
- Mitochondrial glutamate dehydrogenase that catalyzes the conversion of L-glutamate into alpha-ketoglutarate. Plays a key role in glutamine anaplerosis by producing alpha-ketoglutarate, an important intermediate in the tricarboxylic acid cycle (PubMed:11032875, PubMed:11254391, PubMed:16023112, PubMed:16959573). Plays a role in insulin homeostasis (PubMed:11297618, PubMed:9571255). May be involved in learning and memory reactions by increasing the turnover of the excitatory neurotransmitter glutamate (By similarity)..
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1216
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat