Antibodies
Anti-Glut3 Antibody-Oligo Conjugate
SKU: aoc2182
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Glut3 Antibody-PLA1
Antibody Target
- Target
- Solute carrier family 2, facilitated glucose transporter member 3
- UniProt Number
- P11169
- Target Description
- Facilitative glucose transporter (PubMed:26176916, PubMed:32860739, PubMed:9477959). Can also mediate the uptake of various other monosaccharides across the cell membrane (PubMed:26176916, PubMed:9477959). Mediates the uptake of glucose, 2-deoxyglucose, galactose, mannose, xylose and fucose, and probably also dehydroascorbate (PubMed:26176916, PubMed:9477959). Does not mediate fructose transport (PubMed:26176916, PubMed:9477959). Required for mesendoderm differentiation (By similarity)..
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0917
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat