Antibodies
Anti-Glutathione Peroxidase 1 Antibody-Oligo Conjugate
SKU: aoc2187
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Glutathione Peroxidase 1 Antibody-IF1
Antibody Target
- Target
- Glutathione peroxidase 1
- UniProt Number
- P07203
- Target Description
- Catalyzes the reduction of hydroperoxides in a glutathione-dependent manner thus regulating cellular redox homeostasis (PubMed:11115402, PubMed:36608588). Can reduce small soluble hydroperoxides such as H2O2, cumene hydroperoxide and tert-butyl hydroperoxide, as well as several fatty acid-derived hydroperoxides (PubMed:11115402, PubMed:36608588). In platelets catalyzes the reduction of 12-hydroperoxyeicosatetraenoic acid, the primary product of the arachidonate 12-lipoxygenase pathway (PubMed:11115402)..
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53251
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat