Antibodies
Anti-Glutathione Synthetase Antibody-Oligo Conjugate
SKU: aoc2189
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Glutathione Synthetase Antibody-IF1
Antibody Target
- Target
- Glutathione synthetase
- UniProt Number
- P48637
- Target Description
- Catalyzes the production of glutathione from gamma-glutamylcysteine and glycine in an ATP-dependent manner (PubMed:7646467, PubMed:9215686). Glutathione (gamma-glutamylcysteinylglycine, GSH) is the most abundant intracellular thiol in living aerobic cells and is required for numerous processes including the protection of cells against oxidative damage, amino acid transport, the detoxification of foreign compounds, the maintenance of protein sulfhydryl groups in a reduced state and acts as a cofactor for a number of enzymes (PubMed:10369661). Participates in ophthalmate biosynthesis in hepatocytes (By similarity)..
- Molecular Weight
- 52kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0630
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat