Antibodies
Anti-Glycerol kinase (GK) Antibody-Oligo Conjugate
SKU: aoc2191
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Glycerol kinase (GK) Antibody-IF1
Antibody Target
- Target
- Glycerol kinase
- UniProt Number
- P32189
- Target Description
- Kinase that plays a key role in glycerol metabolism, catalyzing its phosphorylation to produce sn-glycerol 3-phosphate. Sn-glycerol 3-phosphate is a crucial intermediate in various metabolic pathways, such as the synthesis of glycerolipids and triglycerides, glycogenesis, glycolysis and gluconeogenesis..
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2376
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat