Antibodies
Anti-Glypican 3 Antibody-Oligo Conjugate
SKU: aoc2193
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Glypican 3 Antibody-IF1
Antibody Target
- Target
- Glypican-3
- UniProt Number
- P51654
- Target Description
- Cell surface proteoglycan (PubMed:14610063). Negatively regulates the hedgehog signaling pathway when attached via the GPI-anchor to the cell surface by competing with the hedgehog receptor PTC1 for binding to hedgehog proteins (By similarity). Binding to the hedgehog protein SHH triggers internalization of the complex by endocytosis and its subsequent lysosomal degradation (By similarity). Positively regulates the canonical Wnt signaling pathway by binding to the Wnt receptor Frizzled and stimulating the binding of the Frizzled receptor to Wnt ligands (PubMed:16227623, PubMed:24496449). Positively regulates the non-canonical Wnt signaling pathway (By similarity). Binds to CD81 which decreases the availability of free CD81 for binding to the transcriptional repressor HHEX, resulting in nuclear translocation of HHEX and transcriptional repression (By similarity). Inhibits the dipeptidyl peptidase activity of DPP4 (PubMed:17549790). Plays a role in limb patterning and skeletal development by controlling the cellular response to BMP4 (By similarity). Modulates the effects of growth factors BMP2, BMP7 and FGF7 on renal branching morphogenesis (By similarity). Required for coronary vascular development (By similarity). Plays a role in regulating cell movements during gastrulation (By similarity)..
- Molecular Weight
- 66kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC56916
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human