Antibodies
Anti-GM130 Antibody-Oligo Conjugate (ARC74579)
SKU: aoc2195
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GM130 Antibody (ARC74579)-IF1
Antibody Target
- Target
- Golgin subfamily A member 2
- UniProt Number
- Q08379
- Target Description
- Peripheral membrane component of the cis-Golgi stack that acts as a membrane skeleton that maintains the structure of the Golgi apparatus, and as a vesicle thether that facilitates vesicle fusion to the Golgi membrane (Probable) (PubMed:16489344). Required for normal protein transport from the endoplasmic reticulum to the Golgi apparatus and the cell membrane (By similarity). Together with p115/USO1 and STX5, involved in vesicle tethering and fusion at the cis-Golgi membrane to maintain the stacked and inter-connected structure of the Golgi apparatus. Plays a central role in mitotic Golgi disassembly: phosphorylation at Ser-37 by CDK1 at the onset of mitosis inhibits the interaction with p115/USO1, preventing tethering of COPI vesicles and thereby inhibiting transport through the Golgi apparatus during mitosis (By similarity). Also plays a key role in spindle pole assembly and centrosome organization (PubMed:26165940). Promotes the mitotic spindle pole assembly by activating the spindle assembly factor TPX2 to nucleate microtubules around the Golgi and capture them to couple mitotic membranes to the spindle: upon phosphorylation at the onset of mitosis, GOLGA2 interacts with importin-alpha via the nuclear localization signal region, leading to recruit importin-alpha to the Golgi membranes and liberate the spindle assembly factor TPX2 from importin-alpha. TPX2 then activates AURKA kinase and stimulates local microtubule nucleation. Upon filament assembly, nascent microtubules are further captured by GOLGA2, thus linking Golgi membranes to the spindle (PubMed:19242490, PubMed:26165940). Regulates the meiotic spindle pole assembly, probably via the same mechanism (By similarity). Also regulates the centrosome organization (PubMed:18045989, PubMed:19109421). Also required for the Golgi ribbon formation and glycosylation of membrane and secretory proteins (PubMed:16489344, PubMed:17314401)..
- Molecular Weight
- 113kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC74579
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat