Antibodies
Anti-GM130 Antibody-Oligo Conjugate (ARC0589)
SKU: aoc2196
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GM130 Antibody (ARC0589)-IF1
Antibody Target
- Target
- Golgin subfamily A member 2
- UniProt Number
- Q08379
- Target Description
- Peripheral membrane component of the cis-Golgi stack that acts as a membrane skeleton that maintains the structure of the Golgi apparatus, and as a vesicle thether that facilitates vesicle fusion to the Golgi membrane (Probable). Required for normal protein transport from the endoplasmic reticulum to the Golgi apparatus and the cell membrane. Together with p115/USO1 and STX5, involved in vesicle tethering and fusion at the cis-Golgi membrane to maintain the stacked and inter-connected structure of the Golgi apparatus. Plays a central role in mitotic Golgi disassembly: phosphorylation at Ser-37 by CDK1 at the onset of mitosis inhibits the interaction with p115/USO1, preventing tethering of COPI vesicles and thereby inhibiting transport through the Golgi apparatus during mitosis. Also plays a key role in spindle pole assembly and centrosome organization. Promotes the mitotic spindle pole assembly by activating the spindle assembly factor TPX2 to nucleate microtubules around the Golgi and capture them to couple mitotic membranes to the spindle: upon phosphorylation at the onset of mitosis, GOLGA2 interacts with importin-alpha via the nuclear localization signal region, leading to recruit importin-alpha to the Golgi membranes and liberate the spindle assembly factor TPX2 from importin-alpha. TPX2 then activates AURKA kinase and stimulates local microtubule nucleation. Upon filament assembly, nascent microtubules are further captured by GOLGA2, thus linking Golgi membranes to the spindle. Regulates the meiotic spindle pole assembly, probably via the same mechanism. Also regulates the centrosome organization. Also required for the Golgi ribbon formation and glycosylation of membrane and secretory proteins.
- Molecular Weight
- 113kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0589
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse