Antibodies
Anti-GOT1 Antibody-Oligo Conjugate
SKU: aoc2206
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GOT1 Antibody-IF1
Antibody Target
- Target
- Aspartate aminotransferase, cytoplasmic
- UniProt Number
- P17174
- Target Description
- Biosynthesis of L-glutamate from L-aspartate or L-cysteine (PubMed:21900944). Important regulator of levels of glutamate, the major excitatory neurotransmitter of the vertebrate central nervous system. Acts as a scavenger of glutamate in brain neuroprotection. The aspartate aminotransferase activity is involved in hepatic glucose synthesis during development and in adipocyte glyceroneogenesis. Using L-cysteine as substrate, regulates levels of mercaptopyruvate, an important source of hydrogen sulfide. Mercaptopyruvate is converted into H(2)S via the action of 3-mercaptopyruvate sulfurtransferase (3MST). Hydrogen sulfide is an important synaptic modulator and neuroprotectant in the brain. In addition, catalyzes (2S)-2-aminobutanoate, a by-product in the cysteine biosynthesis pathway (PubMed:27827456)..
- Molecular Weight
- 46kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0579
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat