Antibodies
Anti-GPI Antibody-Oligo Conjugate (ARC74854)
SKU: aoc2211
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GPI Antibody (ARC74854)-IF1
Antibody Target
- Target
- Glucose-6-phosphate isomerase
- UniProt Number
- P06744
- Target Description
- In the cytoplasm, catalyzes the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Besides it's role as a glycolytic enzyme, also acts as a secreted cytokine: acts as an angiogenic factor (AMF) that stimulates endothelial cell motility. Acts as a neurotrophic factor, neuroleukin, for spinal and sensory neurons. It is secreted by lectin-stimulated T-cells and induces immunoglobulin secretion.
- Molecular Weight
- 63 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC74854
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat