Antibodies
Anti-GPX4 Antibody-Oligo Conjugate
SKU: aoc2214
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GPX4 Antibody-IF1
Antibody Target
- Target
- Phospholipid hydroperoxide glutathione peroxidase GPX4
- UniProt Number
- P36969
- Target Description
- Essential antioxidant peroxidase that directly reduces phospholipid hydroperoxide even if they are incorporated in membranes and lipoproteins. Can also reduce cholesterol hydroperoxide and thymine hydroperoxide. Plays a key role in protecting cells from oxidative damage by preventing membrane lipid peroxidation. Required to prevent cells from ferroptosis, a non-apoptotic cell death resulting from an iron-dependent accumulation of lipid reactive oxygen species. The presence of selenocysteine (Sec) versus Cys at the active site is essential for life: it provides resistance to overoxidation and prevents cells against ferroptosis. The presence of Sec at the active site is also essential for the survival of a specific type of parvalbumin-positive interneurons, thereby preventing against fatal epileptic seizures. May be required to protect cells from the toxicity of ingested lipid hydroperoxides. Required for normal sperm development and male fertility. Essential for maturation and survival of photoreceptor cells. Plays a role in a primary T-cell response to viral and parasitic infection by protecting T-cells from ferroptosis and by supporting T-cell expansion. Plays a role of glutathione peroxidase in platelets in the arachidonic acid metabolism. Reduces hydroperoxy ester lipids formed by a 15-lipoxygenase that may play a role as down-regulator of the cellular 15-lipoxygenase pathway. Can reduce fatty acid-derived hydroperoxides. Can also reduce small soluble hydroperoxides such as H2O2, cumene hydroperoxide and tert-butyl hydroperoxide.
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC65274
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat