Antibodies
Anti-Granzyme A Antibody-Oligo Conjugate
SKU: aoc2215
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Granzyme A Antibody-IF1
Antibody Target
- Target
- Granzyme A
- UniProt Number
- P12544
- Target Description
- Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent pyroptosis when delivered into the target cell through the immunological synapse (PubMed:12819770, PubMed:32299851, PubMed:3257574, PubMed:3262682, PubMed:3263427). It cleaves after Lys or Arg (PubMed:12819770, PubMed:32299851). Once delivered into the target cell, acts by catalyzing cleavage of gasdermin-B (GSDMB), releasing the pore-forming moiety of GSDMB, thereby triggering pyroptosis and target cell death (PubMed:32299851, PubMed:34022140, PubMed:36157507, PubMed:36899106). Cleaves APEX1 after 'Lys-31' and destroys its oxidative repair activity (PubMed:12524539). Cleaves the nucleosome assembly protein SET after 'Lys-189', which disrupts its nucleosome assembly activity and allows the SET complex to translocate into the nucleus to nick and degrade the DNA (PubMed:11555662, PubMed:12628186, PubMed:16818237)..
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCELISA
- Clone
- ARC74697
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human