Antibodies
Anti-GRASP65 Antibody-Oligo Conjugate
SKU: aoc2216
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GRASP65 Antibody-IF1
Antibody Target
- Target
- Golgi reassembly-stacking protein 1
- UniProt Number
- Q9BQQ3
- Target Description
- Key structural protein of the Golgi apparatus. The membrane cisternae of the Golgi apparatus adhere to each other to form stacks, which are aligned side by side to form the Golgi ribbon. Acting in concert with GORASP2/GRASP55, is required for the formation and maintenance of the Golgi ribbon, and may be dispensable for the formation of stacks. However, other studies suggest that GORASP1 plays an important role in assembly and membrane stacking of the cisternae, and in the reassembly of Golgi stacks after breakdown during mitosis. Caspase-mediated cleavage of GORASP1 is required for fragmentation of the Golgi during apoptosis. Also mediates, via its interaction with GOLGA2/GM130, the docking of transport vesicles with the Golgi membranes. Mediates ER stress-induced unconventional (ER/Golgi-independent) trafficking of core-glycosylated CFTR to cell membrane.
- Molecular Weight
- 46kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1911
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat