Antibodies
Anti-GRIK2 Antibody-Oligo Conjugate
SKU: aoc2218
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GRIK2 Antibody-IF1
Antibody Target
- Target
- Glutamate receptor ionotropic, kainate 2
- UniProt Number
- Q13002
- Target Description
- Ionotropic glutamate receptor that functions as a cation permeable ligand-gated ion channel, gated by L-glutamate and the glutamatergic agonist kainic acid. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist. Modulates cell surface expression of NETO2. In association with GRIK3, involved in presynaptic facilitation of glutamate release at hippocampal mossy fiber synapses.; FUNCTION: Independent of its ionotropic glutamate receptor activity, acts as a thermoreceptor conferring sensitivity to cold temperatures. Functions in dorsal root ganglion neurons.
- Molecular Weight
- 103kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1718
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat