Antibodies
Anti-GRIK2 Antibody-Oligo Conjugate
SKU: aoc2218
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GRIK2 Antibody-IF1
Antibody Target
- Target
- Glutamate receptor ionotropic, kainate 2
- UniProt Number
- Q13002
- Target Description
- Ionotropic glutamate receptor that functions as a cation permeable ligand-gated ion channel, gated by L-glutamate and the glutamatergic agonist kainic acid. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. Binding of the excitatory neurotransmitter L-glutamate induces a conformation change, leading to the opening of the cation channel, and thereby converts the chemical signal to an electrical impulse. The receptor then desensitizes rapidly and enters a transient inactive state, characterized by the presence of bound agonist (PubMed:14511640, PubMed:28180184, PubMed:34375587, PubMed:7536611, PubMed:8730589). Modulates cell surface expression of NETO2. In association with GRIK3, involved in presynaptic facilitation of glutamate release at hippocampal mossy fiber synapses (By similarity)..; FUNCTION: Independent of its ionotropic glutamate receptor activity, acts as a thermoreceptor conferring sensitivity to cold temperatures (PubMed:31474366). Functions in dorsal root ganglion neurons (By similarity)..
- Molecular Weight
- 103kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1718
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat