Antibodies
Anti-GRK2 Antibody-Oligo Conjugate
SKU: aoc2220
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GRK2 Antibody-IF1
Antibody Target
- Target
- Beta-adrenergic receptor kinase 1
- UniProt Number
- P25098
- Target Description
- Specifically phosphorylates the agonist-occupied form of the beta-adrenergic and closely related receptors, probably inducing a desensitization of them. Key regulator of LPAR1 signaling. Competes with RALA for binding to LPAR1 thus affecting the signaling properties of the receptor. Desensitizes LPAR1 and LPAR2 in a phosphorylation-independent manner. Positively regulates ciliary smoothened (SMO)-dependent Hedgehog (Hh) signaling pathway by facilitating the trafficking of SMO into the cilium and the stimulation of SMO activity. Inhibits relaxation of airway smooth muscle in response to blue light.
- Molecular Weight
- 80 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1013
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat