Antibodies
Anti-GRP94 Antibody-Oligo Conjugate
SKU: aoc2223
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GRP94 Antibody-IF1
Antibody Target
- Target
- Endoplasmin
- UniProt Number
- P14625
- Target Description
- ATP-dependent chaperone involved in the processing of proteins in the endoplasmic reticulum, regulating their transport. Together with MESD, acts as a modulator of the Wnt pathway by promoting the folding of LRP6, a coreceptor of the canonical Wnt pathway. When associated with CNPY3, required for proper folding of Toll-like receptors. Promotes folding and trafficking of TLR4 to the cell surface. May participate in the unfolding of cytosolic leaderless cargos (lacking the secretion signal sequence) such as the interleukin 1/IL-1 to facilitate their translocation into the ERGIC (endoplasmic reticulum-Golgi intermediate compartment) and secretion; the translocation process is mediated by the cargo receptor TMED10.
- Molecular Weight
- 92kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC60312
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat