Antibodies
Anti-GRSF1 Antibody-Oligo Conjugate
SKU: aoc2224
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GRSF1 Antibody-IF1
Antibody Target
- Target
- G-rich sequence factor 1
- UniProt Number
- Q12849
- Target Description
- Regulator of post-transcriptional mitochondrial gene expression, required for assembly of the mitochondrial ribosome and for recruitment of mRNA and lncRNA. Binds RNAs containing the 14 base G-rich element. Preferentially binds RNAs transcribed from three contiguous genes on the light strand of mtDNA, the ND6 mRNA, and the long non-coding RNAs for MT-CYB and MT-ND5, each of which contains multiple consensus binding sequences. Involved in the degradosome-mediated decay of non-coding mitochondrial transcripts (MT-ncRNA) and tRNA-like molecules. Acts by unwinding G-quadruplex RNA structures in MT-ncRNA, thus facilitating their degradation by the degradosome. G-quadruplexes (G4) are non-canonical 4 stranded structures formed by transcripts from the light strand of mtDNA.
- Molecular Weight
- 53 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC2825
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat