Antibodies
Anti-GSDMD Antibody-Oligo Conjugate (ARC57989)
SKU: aoc2228
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-GSDMD Antibody (ARC57989)-IF1
Antibody Target
- Target
- Gasdermin-D
- UniProt Number
- P57764
- Target Description
- [Gasdermin-D]: Precursor of a pore-forming protein that plays a key role in host defense against pathogen infection and danger signals. This form constitutes the precursor of the pore-forming protein: upon cleavage, the released N-terminal moiety (Gasdermin-D, N-terminal) binds to membranes and forms pores, triggering pyroptosis.; FUNCTION: [Gasdermin-D, N-terminal]: Promotes pyroptosis in response to microbial infection and danger signals. Produced by the cleavage of gasdermin-D by inflammatory caspases CASP1, CASP4 or CASP5 in response to canonical, as well as non-canonical (such as cytosolic LPS) inflammasome activators. After cleavage, moves to the plasma membrane where it strongly binds to inner leaflet lipids, including monophosphorylated phosphatidylinositols, such as phosphatidylinositol 4-phosphate, bisphosphorylated phosphatidylinositols, such as phosphatidylinositol (4,5)-bisphosphate, as well as phosphatidylinositol (3,4,5)-bisphosphate, and more weakly to phosphatidic acid and phosphatidylserine. Homooligomerizes within the membrane and forms pores of 10-15 nanometers (nm) of inner diameter, allowing the release of mature interleukin-1 (IL1B and IL18) and triggering pyroptosis. Gasdermin pores also allow the release of mature caspase-7 (CASP7). In some, but not all, cells types, pyroptosis is followed by pyroptotic cell death, which is caused by downstream activation of ninjurin-1 (NINJ1), which mediates membrane rupture (cytolysis). Also forms pores in the mitochondrial membrane, resulting in release of mitochondrial DNA (mtDNA) into the cytosol. Gasdermin-D, N-terminal released from pyroptotic cells into the extracellular milieu rapidly binds to and kills both Gram-negative and Gram-positive bacteria, without harming neighboring mammalian cells, as it does not disrupt the plasma membrane from the outside due to lipid-binding specificity. Under cell culture conditions, also active against intracellular bacteria, such as Listeria monocytogenes. Also active in response to MAP3K7/TAK1 inactivation by Yersinia toxin YopJ, which triggers cleavage by CASP8 and subsequent activation. Required for mucosal tissue defense against enteric pathogens. Activation of the non-canonical inflammasome in brain endothelial cells can lead to excessive pyroptosis, leading to blood-brain barrier breakdown. Strongly binds to bacterial and mitochondrial lipids, including cardiolipin. Does not bind to unphosphorylated phosphatidylinositol, phosphatidylethanolamine nor phosphatidylcholine.; FUNCTION: [Gasdermin-D, p13]: Transcription coactivator produced by the cleavage by CASP3 or CASP7 in the upper small intestine in response to dietary antigens. Required to maintain food tolerance in small intestine: translocates to the nucleus and acts as a coactivator for STAT1 to induce the transcription of CIITA and MHC class II molecules, which in turn induce type 1 regulatory T (Tr1) cells in upper small intestine.; FUNCTION: [Gasdermin-D, p40]: Produced by the cleavage by papain allergen. After cleavage, moves to the plasma membrane and homooligomerizes within the membrane and forms pores of 10-15 nanometers (nm) of inner diameter, allowing the specific release of mature interleukin-33 (IL33), promoting type 2 inflammatory immune response.
- Molecular Weight
- 53kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC57989
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human