Antibodies
Anti-GSK-3α/β Antibody-Oligo Conjugate (ARC55345)
SKU: aoc2233
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-GSK-3α/β Antibody (ARC55345)-PLA1
Antibody Target
- Target
- Glycogen synthase kinase-3 alpha
- UniProt Number
- P49840
- Additional Target Information
- This antibody also binds Glycogen synthase kinase-3 beta, Uniprot:P49841.
- Target Description
- Constitutively active protein kinase that acts as a negative regulator in the hormonal control of glucose homeostasis, Wnt signaling and regulation of transcription factors and microtubules, by phosphorylating and inactivating glycogen synthase (GYS1 or GYS2), CTNNB1/beta-catenin, APC and AXIN1. Requires primed phosphorylation of the majority of its substrates. Contributes to insulin regulation of glycogen synthesis by phosphorylating and inhibiting GYS1 activity and hence glycogen synthesis. Regulates glycogen metabolism in liver, but not in muscle. May also mediate the development of insulin resistance by regulating activation of transcription factors. In Wnt signaling, regulates the level and transcriptional activity of nuclear CTNNB1/beta-catenin. Facilitates amyloid precursor protein (APP) processing and the generation of APP-derived amyloid plaques found in Alzheimer disease. May be involved in the regulation of replication in pancreatic beta-cells. Is necessary for the establishment of neuronal polarity and axon outgrowth. Through phosphorylation of the anti-apoptotic protein MCL1, may control cell apoptosis in response to growth factors deprivation. Acts as a regulator of autophagy by mediating phosphorylation of KAT5/TIP60 under starvation conditions which activates KAT5/TIP60 acetyltransferase activity and promotes acetylation of key autophagy regulators, such as ULK1 and RUBCNL/Pacer. Negatively regulates extrinsic apoptotic signaling pathway via death domain receptors. Promotes the formation of an anti-apoptotic complex, made of DDX3X, BRIC2 and GSK3B, at death receptors, including TNFRSF10B. The anti-apoptotic function is most effective with weak apoptotic signals and can be overcome by stronger stimulation. Phosphorylates mTORC2 complex component RICTOR at 'Thr-1695' which facilitates FBXW7-mediated ubiquitination and subsequent degradation of RICTOR.
- Molecular Weight
- 46kDa/48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC55345
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat