Antibodies
Anti-GSK3 alpha Antibody-Oligo Conjugate
SKU: aoc2232
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-GSK3 alpha Antibody-PLA1
Antibody Target
- Target
- Glycogen synthase kinase-3 alpha
- UniProt Number
- P49840
- Target Description
- Constitutively active protein kinase that acts as a negative regulator in the hormonal control of glucose homeostasis, Wnt signaling and regulation of transcription factors and microtubules, by phosphorylating and inactivating glycogen synthase (GYS1 or GYS2), CTNNB1/beta-catenin, APC and AXIN1 (PubMed:11749387, PubMed:17478001, PubMed:19366350). Requires primed phosphorylation of the majority of its substrates (PubMed:11749387, PubMed:17478001, PubMed:19366350). Contributes to insulin regulation of glycogen synthesis by phosphorylating and inhibiting GYS1 activity and hence glycogen synthesis (PubMed:11749387, PubMed:17478001, PubMed:19366350). Regulates glycogen metabolism in liver, but not in muscle (By similarity). May also mediate the development of insulin resistance by regulating activation of transcription factors (PubMed:10868943, PubMed:17478001). In Wnt signaling, regulates the level and transcriptional activity of nuclear CTNNB1/beta-catenin (PubMed:17229088). Facilitates amyloid precursor protein (APP) processing and the generation of APP-derived amyloid plaques found in Alzheimer disease (PubMed:12761548). May be involved in the regulation of replication in pancreatic beta-cells (By similarity). Is necessary for the establishment of neuronal polarity and axon outgrowth (By similarity). Through phosphorylation of the anti-apoptotic protein MCL1, may control cell apoptosis in response to growth factors deprivation (By similarity). Acts as a regulator of autophagy by mediating phosphorylation of KAT5/TIP60 under starvation conditions which activates KAT5/TIP60 acetyltransferase activity and promotes acetylation of key autophagy regulators, such as ULK1 and RUBCNL/Pacer (PubMed:30704899). Negatively regulates extrinsic apoptotic signaling pathway via death domain receptors. Promotes the formation of an anti-apoptotic complex, made of DDX3X, BRIC2 and GSK3B, at death receptors, including TNFRSF10B. The anti-apoptotic function is most effective with weak apoptotic signals and can be overcome by stronger stimulation (By similarity). Phosphorylates mTORC2 complex component RICTOR at 'Thr-1695' which facilitates FBXW7-mediated ubiquitination and subsequent degradation of RICTOR (PubMed:25897075)..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0462
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat